WormBase Tree Display for Feature: WBsf705420
expand all nodes | collapse all nodes | view schema
WBsf705420 | SMap | S_parent | Sequence | K07F5 |
---|---|---|---|---|
Name | Public_name | MCM_0000020491 | ||
Sequence_details | Flanking_sequences | actatccatttgcctcttccgaagacaacc | tcgttagcgtatggcagtcagcacagacga | |
Mapping_target | K07F5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=5. Shape score=0.4. Assignement type=unassigned. Mode position in cluster=0. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 5 | |||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |