WormBase Tree Display for Feature: WBsf718034
expand all nodes | collapse all nodes | view schema
WBsf718034 | SMap | S_parent | Sequence | Y55F3C |
---|---|---|---|---|
Name | Public_name | ENH00012326 | ||
Sequence_details | Flanking_sequences | ctactcaatcagcttagaaagtgtctcgaa | ataaactggaagcaattgtgaattgatttc | |
Mapping_target | Y55F3C | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is a predicted enhancer region. These are intergenic TF-binding sites >500 bp from a gene start which overlap a TSS cluster, excluding regions that appear to be unannotated promoters based on having a signature of high H3K4me3/low H3K4me1. Nearest downstream gene=Y55F3C.5. Surounding gene organisation=divergent | ||
SO_term | SO:0000165 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Associations | Associated_with_gene | WBGene00021949 | ||
Remark | [130712 gw3] This is a predicted enhancer region from Julie Ahringer's paper. | |||
Method | enhancer |