WormBase Tree Display for Feature: WBsf899228
expand all nodes | collapse all nodes | view schema
| WBsf899228 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | AGCTGTTGAGAAGCCGCTGCCGCCGCCCCGTTGGCAAAGCTACGGTTACC | GGAATCGAAACCGGCGGCGATGAGGAGGAGGAGGAGGAGGCGCAGGTGAG | |
| Mapping_target | Y54G2A | |||
| DNA_text | cgccgccccgttggcaaagctacggttaccGggaatcgaaaccggcggcgatgaggaggag | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible genome sequence error found in RNASeq analysis of ten lab isolates of N2 by Kate Weber. | ||
| Possible genome sequence error found in RNASeq analysis of N2 and the sister strain LSJ2 from Patrick McGrath. | ||||
| This has NO EST evidence; This overlaps with coding transcript: Y54G2A.27; | ||||
| SNP cgccgccccgttggcaaagctacggttaccGggaatcgaaaccggcggcgatgaggaggag | ||||
| Marked for correction | ||||
| Defined_by | Defined_by_paper | WBPaper00037807 | ||
| WBPaper00040097 | ||||
| Remark | This genome error was corrected in WS235. | |||
| Method | Corrected_genome_sequence_error |
