WormBase Tree Display for Feature: WBsf919588
expand all nodes | collapse all nodes | view schema
| WBsf919588 | SMap | S_parent | Sequence | C07H6 |
|---|---|---|---|---|
| Name | Public_name | pJW8 | ||
| Sequence_details | Flanking_sequences | caaggactgggaggtcctcaatatccaata | tggaagcacctggaaggagacgatgatgat | |
| Mapping_target | C07H6 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This lin-39 enhancer drives expression in a subset of VCNs. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00027690 | ||
| Associations | Associated_with_gene | WBGene00003024 | ||
| Associated_with_Interaction | WBInteraction000521636 | |||
| WBInteraction000541815 | ||||
| Associated_with_expression_pattern | Expr11430 | |||
| Associated_with_construct | WBCnstr00018846 | |||
| Remark | A 1.6 kb fragment covering the first lin-39 intron, which directs GFP expression in a subset of VCNs (Fig. 1L) (See Supplemental Fig. 1B). [2013-07-23 gw3] | |||
| Method | enhancer |
