WormBase Tree Display for Feature: WBsf963071
expand all nodes | collapse all nodes | view schema
WBsf963071 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | actcaaaattgaaatcaaaaattatttcag | gcaatcacacaaacttgctcgacaagccag | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 | 1 | |
RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 | 1 | |||
RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 | 5 | |||
Remark | Defined by RNASeq data (example read: SRR027192.8489577.+.SL2f - 19M8S) from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 1 reads | |||
Defined by RNASeq data (example read: SRR027904.10033251.+.SL2f - 29M) from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 1 reads | ||||
Defined by RNASeq data (example read: SRR137925.8947652.+.SL2h - 66M) from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 5 reads | ||||
Method | SL2 |