WormBase Tree Display for Feature: WBsf963077
expand all nodes | collapse all nodes | view schema
WBsf963077 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ttaaatgcaaataattttattctgtttcag | ttgcataaccttcatcataatgcgaacggc | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 2 | |
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 | 1 | |||
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 2 | |||
Remark | Defined by RNASeq data (example read: SRR089796.30547486.+.SL1 - 30M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 2 reads | |||
Defined by RNASeq data (example read: SRR089362.28660249.+.SL1 - 68M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
Defined by RNASeq data (example read: SRR085465.6976473.+.SL1 - 68M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 1 reads | ||||
Defined by RNASeq data (example read: SRR031114.1273768.+.SL1 - 30M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 2 reads | ||||
Method | SL1 |