WormBase Tree Display for Feature: WBsf963084
expand all nodes | collapse all nodes | view schema
| WBsf963084 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | cctcatcaataatctcttttcctttttcag | agtcaaaactacattgtgtgccggaatccg | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 2 | |
| RNASeq.elegans.CB1370.WBls:0000032.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008138 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR124275.25091604.+.SL1 - 68M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 2 reads | |||
| Defined by RNASeq data (example read: SRR027187.4708722.+.SL1 - 28M) from RNASeq.elegans.CB1370.WBls:0000032.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008138 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089363.8646990.+.SL1 - 67M) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031113.41439324.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031120.51904322.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
| Method | SL1 |
