WormBase Tree Display for Feature: WBsf963089
expand all nodes | collapse all nodes | view schema
| WBsf963089 | SMap | S_parent | Sequence | Y54G2A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tctgcataatttgttggttttttttttcag | ttttcccgctatttacactctcagagccct | |
| Mapping_target | Y54G2A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085111 | 1 | |
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 | 1 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR317083.986471.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085111 with 1 reads | |||
| Defined by RNASeq data (example read: SRR478539.2675079.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR554453.7148057.+.SL1 - 94M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR316929.12872218.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031115.36076405.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | ||||
| Method | SL1 |
