WormBase Tree Display for Feature: WBsf963101
expand all nodes | collapse all nodes | view schema
WBsf963101 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | aaattgcagaattttgagattaatttgtag | aaaaaaaacaaaaaaaaaacgttgaaactg | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 | 3 | |
RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028203 | 2 | |||
Remark | Defined by RNASeq data (example read: SRR068576.10104910.+.SL1 - 20M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 with 3 reads | |||
Defined by RNASeq data (example read: SRR068578.4025351.+.SL1 - 18M) from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028203 with 2 reads | ||||
Method | SL1 |