WormBase Tree Display for Feature: WBsf964530
expand all nodes | collapse all nodes | view schema
WBsf964530 | SMap | S_parent | Sequence | R13A1 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | attgtttcaaaaatgaaactaacctttcag | cttttggagtatctggagtttcaaaaatca | |
Mapping_target | R13A1 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008139 | 1 | |
RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 | 1 | |||
RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 | 2 | |||
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 | 1 | |||
RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 | 1 | |||
RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX050630 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR027189.18231265.+.SL1 - 28M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008139 with 1 reads | |||
Defined by RNASeq data (example read: SRR124275.22283027.+.SL1 - 68M) from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 1 reads | ||||
Defined by RNASeq data (example read: SRR137925.999185.+.SL1 - 67M) from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 2 reads | ||||
Defined by RNASeq data (example read: SRR332927.59458.+.SL1 - 94M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 with 1 reads | ||||
Defined by RNASeq data (example read: SRR493363.910812.+.SL1 - 92M) from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 with 1 reads | ||||
Defined by RNASeq data (example read: SRR139148.1087410.+.SL1 - 28M) from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX050630 with 1 reads | ||||
Method | SL1 |