WormBase Tree Display for Feature: WBsf964532
expand all nodes | collapse all nodes | view schema
| WBsf964532 | SMap | S_parent | Sequence | R13A1 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gaacaaagttcctaagaaagcatcttctag | gttcttacttactgttgagactgatgcacc | |
| Mapping_target | R13A1 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085112 | 1 | |
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 | 1 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
| Remark | Defined by RNASeq data (example read: SRR316196.731020.+.SL1 + 61M112N8M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085112 with 1 reads | |||
| Defined by RNASeq data (example read: SRR332924.5862324.+.SL1 + 61M112N32M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089821.5383795.+.SL1 + 62M6S) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR089302.4139683.+.SL1 + 62M6S) from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 1 reads | ||||
| Defined by RNASeq data (example read: SRR031118.23865561.+.SL1 + 28M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
| Method | SL1 |
