WormBase Tree Display for Feature: WBsf977523
expand all nodes | collapse all nodes | view schema
WBsf977523 | SMap | S_parent | Sequence | ZK154 |
---|---|---|---|---|
Name | Public_name | UNC-86 binding site (M7 site 3) | ||
Sequence_details | Flanking_sequences | ctttccttcttctttcgtttctctcggacc | atgcgcagcgatggtcgcacacactacaac | |
Mapping_target | ZK154 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Binding site for UNC-86 transcription factor (M7 site 3), within the promoter region of mec-7 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00003265 | ||
Associations | Associated_with_gene | WBGene00003171 | ||
Associated_with_Interaction | WBInteraction000524135 | |||
WBInteraction000524237 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000094 | |||
Bound_by_product_of | WBGene00006818 | |||
Method | TF_binding_site |