WormBase Tree Display for Feature: WBsf978357
expand all nodes | collapse all nodes | view schema
| WBsf978357 | SMap | S_parent | Sequence | C04G2 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ggtcaaacgctcgatgagccgcaaaggctg | acctatttggagaaattatccttacccaac | |
| Mapping_target | C04G2 | |||
| Origin | Species | Caenorhabditis elegans | ||
| History | Acquires_merge | WBsf978360 | ||
| Visible | Description | Promoter region of C04G2.7. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001204 | ||
| Associated_with_Interaction | WBInteraction000528317 | |||
| WBInteraction000528318 | ||||
| WBInteraction000528319 | ||||
| WBInteraction000528320 | ||||
| Remark | [150922 gw3] This is a region upstream of C04G2.7 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
