WormBase Tree Display for Feature: WBsf978550
expand all nodes | collapse all nodes | view schema
| WBsf978550 | SMap | S_parent | Sequence | C17C3 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | cagatgatgacgaagttggagaggaagaca | tcaattcacagtctccgccgaaatttccca | |
| Mapping_target | C17C3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of C17C3.7. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001964 | ||
| Associated_with_Interaction | WBInteraction000528559 | |||
| WBInteraction000528560 | ||||
| WBInteraction000528561 | ||||
| WBInteraction000528562 | ||||
| WBInteraction000528563 | ||||
| WBInteraction000528564 | ||||
| WBInteraction000528565 | ||||
| WBInteraction000528566 | ||||
| WBInteraction000528567 | ||||
| WBInteraction000528568 | ||||
| Remark | [150922 gw3] This is a region upstream of C17C3.7 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
