WormBase Tree Display for Feature: WBsf978989
expand all nodes | collapse all nodes | view schema
| WBsf978989 | SMap | S_parent | Sequence | K10B3 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | agcaccacttccacttccagatcctgacat | aaaacatgaccgattttctgactggaatgg | |
| Mapping_target | K10B3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of gpd-3. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00001685 | ||
| Associated_with_Interaction (23) | ||||
| Remark | [150922 gw3] This is a region upstream of gpd-3 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
