WormBase Tree Display for Feature: WBsf979138
expand all nodes | collapse all nodes | view schema
WBsf979138 | SMap | S_parent | Sequence | B0395 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | agacagtctacaatattacatactacctca | ctgaaattatttagtgattttttaattgaa | |
Mapping_target | B0395 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Promoter region of mir-84. | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00003312 | ||
Associated_with_Interaction | WBInteraction000534640 | |||
WBInteraction000534641 | ||||
WBInteraction000534642 | ||||
WBInteraction000534643 | ||||
WBInteraction000534644 | ||||
WBInteraction000534645 | ||||
WBInteraction000534646 | ||||
WBInteraction000534647 | ||||
WBInteraction000534648 | ||||
WBInteraction000534649 | ||||
Remark | [150922 gw3] This is a region upstream of mir-84 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |