WormBase Tree Display for Construct: WBCnstr00017749
expand all nodes | collapse all nodes | view schema
WBCnstr00017749 | Other_name | Expr10821_Ex | |
---|---|---|---|
Summary | [Punc-63::YFP] | ||
Driven_by_gene | WBGene00006797 | ||
Fusion_reporter | YFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | A 2.4 kb region upstream of the unc-63 ATG, plus the first three codons, was PCR amplified with the following primers: 5'GGGGAAGTTTGTACAAAAAAGCAGGCTGCAAGGCTTCTATATACACTACGCATATC3' and 5'GGGGACCACTTTGTACAAGAAAGCTGGGTAACCGTGGTCATTTGGTCCCATTAACCTG3'. -- precise ends. | ||
Used_for | Transgene_construct | WBTransgene00018364 | |
Reference | WBPaper00038246 |