WormBase Tree Display for Construct: WBCnstr00018793
expand all nodes | collapse all nodes | view schema
WBCnstr00018793 | Other_name | Expr11350_Ex | |
---|---|---|---|
Summary | [inx-1::GFP] | ||
Driven_by_gene | WBGene00002123 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [inx-1::GFP] transcriptional fusion. Plasmid for inx-1 (wp1264): a promoter sequence before the translation initiation site was amplified by PCR with genomic DNA as a template, and used to replace Pmyo-3 in pPD118.20 by cutting with Pst1 and BamH1 restriction enzymes. The sequences of the PCR primers were TGTCTCTGCTTTGCACGATT (sense) and attggatccGGCGGACAAGAACTGCAAT (antisense). | ||
Clone | pPD118.20 | ||
Used_for | Transgene_construct | WBTransgene00031466 | |
Reference | WBPaper00044311 | ||
Remark | [inx-1::GFP] transcriptional fusion. Plasmid for inx-1 (wp1264): a promoter sequence before the translation initiation site was amplified by PCR with genomic DNA as a template, and used to replace Pmyo-3 in pPD118.20 by cutting with Pst1 and BamH1 restriction enzymes. The sequences of the PCR primers were TGTCTCTGCTTTGCACGATT (sense) and attggatccGGCGGACAAGAACTGCAAT (antisense). |