WormBase Tree Display for Construct: WBCnstr00038191
expand all nodes | collapse all nodes | view schema
| WBCnstr00038191 | Summary | [loxp-Plect-2::LECT-2::SL2::mCherry-loxp] | |
|---|---|---|---|
| Driven_by_gene | WBGene00019407 | ||
| Gene | WBGene00019407 | ||
| Fusion_reporter | mCherry | ||
| Recombination_site | LoxP | ||
| Construction_summary | Most of the plasmid constructs were generated in pSM delta vector (a derivative of pPD49.26 with additional cloning sites). For details and complete lists of plasmids see Supplemental file 1. lect-2 cDNA was amplified from a mix-stage worm cDNA library (kindly provided by Dr. Kota Mizumoto) using primers oWZ447 (gc gcatgc ttacaagcattgacactccctt) and oWZ450 (cg cccgggttagaatactggaaagttcggag). Plect-2(1.5kb)::lect-2 genomic DNA was amplified similarly, except that oWZ448 (gc ggcgcgcc cagtatgaaaaaaaaaggaaatttctcagaatcc) was used as the forward primer. pWZ347 was a derivative of pCFJ909 (miniMos vector, kindly provided by Dr. Christian Frkjr-Jensen) with additional cloning sites and two loxp sites flanked the multiple cloning sites. Plect-2(1.5kb)::lect-2::SL2::mcherry::unc-54 was cut from a pSM delta-based intermediate construct and inserted into pWZ347 and used to make the single copy transgene wyTi3. | ||
| Used_for | Transgene_construct | WBTransgene00023589 | |
| Reference | WBPaper00050252 |
