WormBase Tree Display for Expr_pattern: Expr5089
expand all nodes | collapse all nodes | view schema
Expr5089 | Expression_of | Gene | WBGene00004457 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004457 | ||
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0005300 | |||
WBbt:0005735 | |||
WBbt:0006749 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [rpm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCCTTCTGTTTATACAATTTGG] 3' and primer B 5' [GAACGAGATTTGGATATTCTTTGG] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
Strain: BC11397 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002578 |