Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5434

expand all nodes | collapse all nodes | view schema

Name Class

Expr5434Expression_ofGeneWBGene00016448
Reflects_endogenous_expression_ofWBGene00016448
HomolHomol_homolC35D10:Expr
Expression_dataLife_stage (2)
Anatomy_term (6)
TypeReporter_gene[C35D10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCGTTTGAGCACGCA] 3' and primer B 5' [CCGAACTTATGCTGATACTGTTT] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12383
ReferenceWBPaper00006525
TransgeneWBTransgene00002908