WormBase Tree Display for Expr_pattern: Expr5633
expand all nodes | collapse all nodes | view schema
| Expr5633 | Expression_of | Gene | WBGene00004207 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004207 | ||
| Homol | Homol_homol | D2089:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (12) | |||
| Type | Reporter_gene | [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'. | |
| Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; vulval muscle; spermatheca; head mesodermal cell; unidentified cells in head; | ||
| Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing uterus; developing spermatheca; head mesodermal cell; unidentified cells in head; unidentified cells in tail ; | |||
| Picture | WBPicture0000009260 | ||
| WBPicture0000009261 | |||
| Remark | Also expressed in (comments from author) : the pharyngeal bulbs express but not the isthmus | ||
| Strain: BC11352 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004256 |
