Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6008

expand all nodes | collapse all nodes | view schema

Name Class

Expr6008Expression_ofGeneWBGene00009587
Reflects_endogenous_expression_ofWBGene00009587
HomolHomol_homolF40F11:Expr
Expression_dataLife_stage (2)
Anatomy_term (13)
TypeReporter_gene[F40F11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCGCCATTAAGAAGTACAGTAAC] 3' and primer B 5' [TTGTTTCCGAATCATTATCTTGTT] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; unidentified cells;
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00002903