WormBase Tree Display for Expr_pattern: Expr6730
expand all nodes | collapse all nodes | view schema
| Expr6730 | Expression_of | Gene | WBGene00020647 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00020647 | ||||
| Homol | Homol_homol | T21D12:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0003679 | ||||
| WBbt:0003681 | |||||
| WBbt:0003822 | |||||
| WBbt:0003833 | |||||
| WBbt:0003929 | |||||
| WBbt:0003931 | |||||
| WBbt:0004506 | |||||
| WBbt:0004520 | |||||
| WBbt:0005300 | |||||
| WBbt:0005319 | |||||
| WBbt:0005733 | |||||
| WBbt:0005735 | |||||
| WBbt:0005738 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005747 | |||||
| WBbt:0005753 | |||||
| WBbt:0005772 | |||||
| WBbt:0005812 | |||||
| WBbt:0005813 | |||||
| WBbt:0005821 | |||||
| WBbt:0006748 | |||||
| WBbt:0006749 | |||||
| WBbt:0006751 | |||||
| WBbt:0006759 | |||||
| WBbt:0006760 | |||||
| WBbt:0006789 | |||||
| Type | Reporter_gene | [T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'. | |||
| Pattern | Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ; | ||||
| Larval Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ; | |||||
| Remark | Also expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis | ||||
| Strain: BC11319 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00002557 |
