Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6730

expand all nodes | collapse all nodes | view schema

Name Class

Expr6730Expression_ofGeneWBGene00020647
Reflects_endogenous_expression_ofWBGene00020647
HomolHomol_homolT21D12:Expr
Expression_dataLife_stage (2)
Anatomy_term (25)
TypeReporter_gene[T21D12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTCGTGACGCATTTG] 3' and primer B 5' [CTGGTGGAAGAGGGATTTTCT] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; uterine-seam cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; neurons along body; tail neurons; unidentified cells in body ;
RemarkAlso expressed in (comments from author) : Mosaic population.Neural head and tail is possibly amphid/phasmid, but masked by pharynx and hypodermis
Strain: BC11319
ReferenceWBPaper00006525
TransgeneWBTransgene00002557