Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7004

expand all nodes | collapse all nodes | view schema

Name Class

Expr7004Expression_ofGeneWBGene00012985
Reflects_endogenous_expression_ofWBGene00012985
HomolHomol_homolY48C3A:Expr
Expression_dataLife_stage (2)
Anatomy_term (18)
TypeReporter_gene[Y48C3A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAAAGGAGGAAGAAGCGG] 3' and primer B 5' [GCCTTTGATAATTGGATTCTGA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; Reproductive System; developing uterus; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ;
PictureWBPicture0000006850
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00003141