WormBase Tree Display for Feature: WBsf919605
expand all nodes | collapse all nodes | view schema
| WBsf919605 | SMap | S_parent | Sequence | T18D3 |
|---|---|---|---|---|
| Name | Public_name | Region 'C183' | ||
| Sequence_details | Flanking_sequences | cacactgtactcattgttctggataaaattc | tctctgcattgagccggcttcttcactatct | |
| Mapping_target | T18D3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | The 'C183' region enhancer for myo-2. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00002011 | ||
| Associations | Associated_with_gene | WBGene00003514 | ||
| Associated_with_Interaction | WBInteraction000520182 | |||
| Associated_with_expression_pattern | Expr11411 | |||
| Associated_with_construct | WBCnstr00018827 | |||
| Remark | The 'C183' region enhancer for myo-2 driving expression in the pharynx. [2013-07-23 gw3] | |||
| Method | enhancer |
