WormBase Tree Display for Feature: WBsf978618
expand all nodes | collapse all nodes | view schema
| WBsf978618 | SMap | S_parent | Sequence | F38C2 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ttgggacgtcaacggcaagtggattagaca | tgttgaagcaagcaaccaagaaaactctct | |
| Mapping_target | F38C2 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of F38C2.7. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00009539 | ||
| Associated_with_Interaction | WBInteraction000529750 | |||
| WBInteraction000529751 | ||||
| WBInteraction000529752 | ||||
| WBInteraction000529753 | ||||
| WBInteraction000529754 | ||||
| WBInteraction000529755 | ||||
| WBInteraction000529756 | ||||
| WBInteraction000529757 | ||||
| WBInteraction000529758 | ||||
| Remark | [150922 gw3] This is a region upstream of F38C2.7 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
