WormBase Tree Display for Feature: WBsf978863
expand all nodes | collapse all nodes | view schema
WBsf978863 | SMap | S_parent | Sequence | F56A12 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | actaaaaccaaagaaaaccgaaatataaac | acagaccatccgccaattgacacttcttca | |
Mapping_target | F56A12 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00006775 | ||
Associated_with_Interaction | WBInteraction000530190 | |||
WBInteraction000530191 | ||||
WBInteraction000530192 | ||||
Remark | [150922 gw3] This is a region upstream of F56A12.1 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |