WormBase Tree Display for RNAi: WBRNAi00076945
expand all nodes | collapse all nodes | view schema
WBRNAi00076945 | Homol | Homol_homol | C53C11:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gctcaaagcatgttggaagaaatgcatcaacgtctattgcaaaattctatccaacaagtttttcgcagtcgttgtcatgctcggaacagcaatctattggtactttgccatctatgggctcatgacaatgaaaactcgcttggacgcagttaaaattcttccaaaagattcaccattgcaacgcccaaatttggtgctcaccaatcttgtctgggcaaactaccatcccgtcaccattcttataaatgctccattggatctagaaaaccggcatcaaatggatagatattggaatatggtcgatgaatttgaaaaaatgcacaattgcaagggaaaagcttcaactctttcttggctccgtgattatatcaaattttcctatcacggggaaccattcaatctgttcgctttctttggtttaatgaccccggaggtttatgaagaagtggatccatatcaggcaaacatcacaactgcaaaacttccagagtttttgaaatctccgttcttcaaacattgggatagttttattca | |||
Experiment | Laboratory | PK | |||
Date | 27 Jun 2005 00:00:00 | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | C53C11.3 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004220 | Inferred_automatically | RNAi_primary | ||
Transcript | C53C11.3.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00026841 | ||||
Phenotype | WBPhenotype:0000229 | ||||
WBPhenotype:0000643 | Remark | tendency to curl and become immobile | |||
WBPhenotype:0001395 | Remark | fluid filled vacuoles in intestine and hypodermis | |||
WBPhenotype:0001428 | |||||
Phenotype_not_observed | WBPhenotype:0000062 | ||||
WBPhenotype:0000696 | |||||
Method | RNAi |