WormBase Tree Display for RNAi: WBRNAi00079147
expand all nodes | collapse all nodes | view schema
| WBRNAi00079147 | Homol | Homol_homol | C45G3:RNAi | |||
|---|---|---|---|---|---|---|
| R05D3:RNAi | ||||||
| Sequence_info | DNA_text | gaagaacaggagcgtttagagatgcttttccagtcattatcagaagatcagaagaacttcgtcaagacgaataaccttagtgtgtctattgaggacgatgccaacactcctgaacttagaaggatcttgagacaaaccagagaactcaagagaaagcaacaggaaattgcgagaaaactgggaaacatcgagagaaatgcgttagctgttcgtgatggcggggaggattcgtccgacagtagatcagatgctgggcacgatgttgctatccttcacggtgacgacagtcaactcttcgaaaattcaatgcaattggatcagaaatctcaattgcaaaatgatgagactcaaattcttgagaataaaaagaaggcagctgttgtcattcagaaaatgatacgtggtttcattgcacggcgtaaattccaaatggaaattagcaatattcgcaatcgcatgatccaatacaatcacatattggcgcaagaagacgagcaaattggtatagaagaaatggaggataaatcagtcgaggcaaagctaaagaaatgcgctcttcatggactcacaaatgataaccttcacgtcgttcatgttgctgcaactgtcatcgaccgagtcaccgatcttgttccatcacttttggaaaagcttgtcgtcgaactgaatggcatcaagtcgatcactgatgttttgattgtggcggatcgaggattctcttatacgagcattcttcatccattattgaatgttctcgaaaaattattcacgaagattcccgaagaagtcaccaattcgcatattctccctcacttgaagattttgtcgcctcgcttgatgctactgatgctgaagcactcggaagtcaaggaattgtttattcctatcattaacaccttgacttcaattgctagaagattcccagacaaaaagcaatcgagtttttcttcatcaagctactcaatcaagcagtcgctcaaaaaagtcaaggatcaggagtgtcggaat | ||||
| PCR_product | sjj_R05D3.7 | |||||
| Experiment | Laboratory | SV | ||||
| Date | 26 Nov 2008 00:00:00 | |||||
| Genotype | GFP-H2B | |||||
| Treatment | unc-116 RNAi was performed by feeding; aspm-1 RNAi was performed by injection. | |||||
| Temperature | 20 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | ZC262.7 | Inferred_automatically | RNAi_primary | ||
| R05D3.7 | Inferred_automatically | RNAi_primary | ||||
| C45G3.1 | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00043948 | Inferred_automatically | RNAi_primary | |||
| WBGene00008107 | Inferred_automatically | RNAi_primary | ||||
| WBGene00006840 | Inferred_automatically | RNAi_primary | ||||
| Transcript | ZC262.7.1 | Inferred_automatically | RNAi_primary | |||
| C45G3.1.1 | Inferred_automatically | RNAi_primary | ||||
| R05D3.7.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00032910 | |||||
| Phenotype | WBPhenotype:0001869 | Remark | migration of the meiotic spindle to the cell cortex does not occur; authors point out that the late migration typical of unc-116 RNAi fails to occur | |||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Method | RNAi |
