WormBase Tree Display for RNAi: WBRNAi00083323
expand all nodes | collapse all nodes | view schema
| WBRNAi00083323 | Homol | Homol_homol | B0207:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | aaaatttactattaacgatttcgagatcggaagaccactgggaaaaggaaaattcggcagtgtttacctggctcgcacaaaaactggacatttccatgtagcgatcaaggttctattcaaatcgcaactcatctcaggaggcgtcgagcatcaattggagcgtgaaattgagattcaatctcatttgaatcacccgaatattatcaagctctacacatatttttgggatgcgaagaagatctatctcgttttggaatatgcccccggaggcgaaatgtacaagcaattgacagtgagcaagagattctcagagccaacagctgcaaaatatatgtatgagatcgcagatgctttgtcatattgccacaggaaaaatgtgattcatcgcgacattaaaccggagaatttgcttatcggatcacaaggagaattgaaaattggagattttggatggagtgttcatgctccttcgaataagcgccaaacaatgtgcggaacaatggactatctccctcctgaaatggtgaatggagccgatcacagtgacgcagttgacttatgggcaatcggcgttctctgctatgagtttctcgttggaaaacccccattcgagcacgaagatcagtccaagacatatgcggcaatcaaagcggcacggtttacttaccctgattctgtgaagaagggtgcacgagatttgattggaagattgcttgtcgttgatcccaaggctcgctgtacgcttgaacaggtgaaggaacactactggatccagggaatgatggaggcaaaaattagagctgagaagcagcaaaagattgaaaaagaagcaagtcttcggaatcactga | |||
| Experiment | Laboratory | JS | |||
| Date | 31 Oct 2004 00:00:00 | ||||
| Treatment | Treated animals and their progeny were assayed for RNAi effects after incubation at 15, 20, or 25C for 2024 h. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | B0207.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000099 | Inferred_automatically | RNAi_primary | ||
| Transcript | B0207.4.1 | Inferred_automatically | RNAi_primary | ||
| B0207.4.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024607 | ||||
| Phenotype | WBPhenotype:0000425 | ||||
| WBPhenotype:0001403 | Remark | BMK-1 localization to meiotic and mitotic spindle microtubules was dramatically reduced | |||
| Penetrance | Complete | ||||
| Method | RNAi |
