WormBase Tree Display for RNAi: WBRNAi00091265
expand all nodes | collapse all nodes | view schema
WBRNAi00091265 | Homol | Homol_homol | B0207:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | GCGCCAAACAATGTGCGGAACAATGGACTATCTCCCTCCTGAAATGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATGGGCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAACCCCCATTCGAGCACGAAGATCAGTCCAAGACATATGCGGCAATCAAAGCGGCACGGTTTACTTACCCTGATTCTGTGAAGAAGGGTGCACGAGATTTGATTGGAAGATTGCTTGTCGTTGATCCCAAGGCTCGCTGTACGCTTGAACAGGTTTGTTATTGATTTCAGCTTAGTGGCCAACATATTATCAGCACACAGAAGTACACTTTTGTAGTGTTCTTAATTATCATAATTCATTAAATTATTACAGGTGAAGGAACACTACTGGATCCAGGGAATGATGGAGGCAAAAATTAGAGCTGAGAAGCAGCAAAAGATTGAAAAAGAA | |||
Experiment (3) | |||||
Inhibits | Predicted_gene | B0207.4 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00000099 | Inferred_automatically | RNAi_primary | ||
Transcript (2) | |||||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00003548 | ||||
Phenotype | WBPhenotype:0000040 | Remark | Embryonic development arrests during the first cell cycle due to incomplete chromosome segregation. The centrosome cycle appears to be unaffected. | ||
WBPhenotype:0000050 | |||||
WBPhenotype:0000773 | Remark | Embryonic development arrests during the first cell cycle due to incomplete chromosome segregation. The centrosome cycle appears to be unaffected. | |||
WBPhenotype:0001886 | Remark | The cleavage furrow could be clearly seen to retreat and disappear. | |||
Phenotype_not_observed | WBPhenotype:0001110 | Remark | In stu-7/air-2 (RNAi) embryos pronuclear fusion, centrosome duplication and rotation and the nucleation of bipolar microtubule spindle asters proceed normally. | ||
WBPhenotype:0001151 | Remark | In stu-7/air-2 (RNAi) embryos pronuclear fusion, centrosome duplication and rotation and the nucleation of bipolar microtubule spindle asters proceed normally. | |||
WBPhenotype:0001903 | Remark | The centrosome cycle appears to be unaffected. | |||
Method | RNAi |