WormBase Tree Display for RNAi: WBRNAi00095093
expand all nodes | collapse all nodes | view schema
| WBRNAi00095093 | Homol | Homol_homol | CHROMOSOME_I:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cgatgtgatctcttgtgtggaattttcacacgatggtgaatatttggcaacgggagacaaaggaggacgtgttgtaattttccaacgagatcagagtgtaggttttagtttttagaaagacgagaactgttttaaatatttaatttttcagggaaagtatgtgaaaggcgttcgatcgagggaatataatgtttactcgacatttcaatctcatgaacctgaatttgattatttgaaatcactagaaattgacgagaaaattaatcaaattcggtggcttaaaaagaagaatgcagccaatttcattctctcgaccaacgacaaaacaatcaagctgtggaaaattagtgaaagagagcgtaaaattggagacgatgcatggaatctgcctagaacaaacagaatcaagtataacattaatgattaaatattttaaatatataaatataattttcagcacttcctccttccgaggtcgcttacaaataccctcgatcgtgccaatggagttgatagttgaagcaagtccgagacgagtttacggaaatgctcacacttatcacgtcaacagtatttcagtgaattctgatcaggtattttaataatttttttttgtgttcagcttttttcaatccaaagtatacgatgaatcaaaatctcaacagtataaccttcttcacatgttcggcgtatttttttaactattcaatttattagaaaaatagtaccaggttggctgaattcttttttgtgaaaatttaaaatgtttggtactgcaaggaccaaaatatcaattatgtataagtgaaccgaaattaaaaattatattccgattttcaggaaacattcctatctgccgacgatttgc | |||
| Experiment | Laboratory | OC | |||
| Date | 28 Feb 2011 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Treatment | Young adult worms were injected with dsRNA, allowed to recover, and analyzed after 36-48 hours at 25 degrees Celsius | ||||
| Temperature | 25 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F26E4.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006352 | Inferred_automatically | RNAi_primary | ||
| Transcript | F26E4.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00038325 | ||||
| Phenotype | WBPhenotype:0000746 | Remark | sur-6(RNAi) embryos exhibit both monopolar spindles and asymmetric spindles in which one spindle pole was smaller than the other | ||
| Penetrance | Range | 71 | |||
| WBPhenotype:0001102 | Remark | sur-6(RNAi) embryos exhibit both monopolar spindles and asymmetric spindles in which one spindle pole was smaller than the other | |||
| Penetrance | Range | 71 | |||
| WBPhenotype:0001876 | Remark | sur-6(RNAi) embryos exhibit both monopolar spindles and asymmetric spindles in which one spindle pole was smaller than the other | |||
| Penetrance | Range | 71 | |||
| WBPhenotype:0001903 | Remark | sur-6(RNAi) embryos exhibit both monopolar spindles and asymmetric spindles in which one spindle pole was smaller than the other | |||
| Penetrance | Range | 71 | |||
| Remark | sur-6 RNAi | ||||
| Method | RNAi |
