WormBase Tree Display for RNAi: WBRNAi00117212
expand all nodes | collapse all nodes | view schema
| WBRNAi00117212 | Homol | Homol_homol | B0207:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGGAGAATAAGCCACCTGTAATCAACCTTCCAGAGAAGGAAACTGTGAATACTCCACAGAAGGGAGGAAAATTTACTATTAACGATTTCGAGATCGGAAGACCACTGGGAAAAGGAAAATTCGGCAGTGTTTACCTGGCTCGCACAAAAACTGGACATTTCCATGTAGCGATCAAGGTTCTATTCAAATCGCAACTCATCTCAGGAGGCGTCGAGCATCAATTGGAGCGTGAAATTGAGATTCAATCTCATTTGAATCACCCGAATATTATCAAGCTCTACACATATTTTTGGGATGCGAAGAAGATCTATCTCGTTTTGGAATATGCCCCCGGAGGCGAAATGTACAAGCAATTGACAGTGAGCAAGAGATTCTCAGAGCCAACAGCTGCAAAATATATGTATGAGATCGCAGATGCTTTGTCATATTGCCACAGGAAAAATGTGATTCATCGCGACATTAAACCGGAGAATTTGCTTATCGGATCACAAGGAGAATTGAAAATTGGAGATTTTGGATGGAGTGTTCATGCTCCTTCGAATAAGCGCCAAACAATGTGCGGAACAATGGACTATCTCCCTCCTGAAATGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATGGGCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAACCCCCATTCGAGCACGAAGATCAGTCCAAGACATATGCGGCAATCAAAGCGGCACGGTTTACTTACCCTGATTCTGTGAAGAAGGGTGCACGAGATTTGATTGGAAGATTGCTTGTCGTTGATCCCAAGGCTCGCTGTACGCTTGAACAGGTGAAGGAACACTACTGGATCCAGGGAATGATGGAGGCAAAAATTAGAGCTGAGAAGCAGCAAAAGATTGAAAAAGAAGCAAGTCTTCGGAATCACTGA | |||
| Experiment | Delivered_by | Injection | |||
| Inhibits | Predicted_gene | B0207.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000099 | Inferred_automatically | RNAi_primary | ||
| Transcript | B0207.4.1 | Inferred_automatically | RNAi_primary | ||
| B0207.4.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004268 | ||||
| Phenotype | WBPhenotype:0000775 | Remark | In all cases where embryos are observed with two partially decondensed pronuclei (equivalent to postmeiotic stage in a wild-type zygote) one pronucleus always had an abnormally high DNA content. These abnormal pronuclei were unequivocally identified as being of oocyte origin following careful examination of embryos that were retained in the uterus and could be oriented. Based upon the high DNA content in oocyte pronuclei and the lack of detectable polar body, we conclude that meiosis fails to occur in air-2(RNAi) embryos. | ||
| WBPhenotype:0001041 | Remark | In all cases where embryos are observed with two partially decondensed pronuclei (equivalent to postmeiotic stage in a wild-type zygote) one pronucleus always had an abnormally high DNA content. These abnormal pronuclei were unequivocally identified as being of oocyte origin following careful examination of embryos that were retained in the uterus and could be oriented. Based upon the high DNA content in oocyte pronuclei and the lack of detectable polar body, we conclude that meiosis fails to occur in air-2(RNAi) embryos. | |||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. Authors did note they used clone yk274b8. | ||||
| Method | RNAi |
