WormBase Tree Display for Strain: WBStrain00007130
expand all nodes | collapse all nodes | view schema
| WBStrain00007130 | Status | Live | ||
|---|---|---|---|---|
| Genotype | gon-2(q388) I; gem-1(bc364) X. | |||
| Public_name | EJ1171 | |||
| Contains | Gene | WBGene00001651 | ||
| WBGene00008214 | ||||
| Variation | WBVar00241100 | |||
| WBVar02147600 | ||||
| Properties | Outcrossed | x4 | ||
| Mutagen | EMS | |||
| CGC_received | 13 Mar 2017 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson352 | |||
| Remark | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
