General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBStrain00028975 | Status | Live | ||
|---|---|---|---|---|
| Genotype | mut-7(pk720) III. | |||
| Public_name | NL1820 | |||
| Contains | Gene | WBGene00003504 | ||
| Variation | WBVar00239332 | |||
| Properties | Mutagen | EMS | ||
| CGC_received | 09 Jan 2006 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson1159 | |||
| Remark | Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
