Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00034104

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00034104StatusLive
Genotypesmg-1(cc546) I; pha-4(zu225) V.
Public_nameSM190
ContainsGeneWBGene00004013
WBGene00004879
Variation (2)
PropertiesOutcrossedx>4
MutagenEMS
CGC_received29 Aug 2008 00:00:00
LocationCGC
RemarkMade_by: Mary Ellen DomeierCGC_data_submission
WBStrain mapped, WBPaper00059578 added based on AFP_Strain data.Curator_confirmedWBPerson1983
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]Inferred_automaticallyFrom CGC strain data
ReferenceWBPaper00059578
SpeciesCaenorhabditis elegans