WormBase Tree Display for Strain: WBStrain00049354

WBStrain00049354 Evidence: Curator_confirmed: WBPerson1983
  Status: Live
  Genotype: vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)].
  Public_name: RG3115
  Contains: Gene: WBGene00003514
      WBGene00004496
      WBGene00006745
      WBGene00006789
      WBGene00006920
    Variation: WBVar02154174
      WBVar02148984
    Rearrangement: tmC25
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 06 Jul 2020 00:00:00
  Location: CGC
  Remark: Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgaaaaatgtttttttttaattgggtgtag ; Right flanking sequence: CTCGGCAATTTTGCTCTTATCTTCCTCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
    Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+dead eggs (ve615 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tgaaaaatgtttttttttaattgggtgtag ; Right flanking sequence: CTCGGCAATTTTGCTCTTATCTTCCTCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
    Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615). Inferred_automatically: From CGC strain data
    Made_by: RG KO Group CGC_data_submission
  Species: Caenorhabditis elegans