WormBase Tree Display for Transgene: WBTransgene00015436
expand all nodes | collapse all nodes | view schema
| WBTransgene00015436 | Public_name | WBPaper00041200Ex2 | |
|---|---|---|---|
| Summary | [nhr-239::gfp] | ||
| Synonym | Expr10053_Ex | ||
| Construction | Construct | WBCnstr00015025 | |
| Construction_summary | The nhr-239::gfp plasmid, pNHR239GFP1, was constructed by amplifying a 2.8 kb region from wild-type C. elegans genomic DNA using the following oligonucleotides: OY54IL TTTTCAGATTCTAGGCCGTCAOY5431X CACCCGGGCAACCTTGTGCATTTTGCAA and ligating the product to pPD95.79 using XbaI and XmaI. The resulting plasmid fused 2.1 kb of 5' flanking DNA, which includes the last intron and exon of the adjacent upstream feh-1 gene, and the first three predicted exons of the nhr-239 gene to the coding sequence for GFP. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr10053 | |
| Reference | WBPaper00041200 | ||
| Species | Caenorhabditis elegans |
