WormBase Tree Display for Transgene: WBTransgene00017849
expand all nodes | collapse all nodes | view schema
WBTransgene00017849 | Public_name | WBPaper00042122Ex4 | |
---|---|---|---|
Summary | [lin-12(mutated LAG-1 binding sites)::YFP] | ||
Construction | Construct | WBCnstr00017240 | |
Coinjection_other | myo-2::YFP | ||
Construction_summary | The lin-12(mutated LAG-1 binding sites)::YFP transcriptional fusion construct was prepared by cloning a PCR-amplified genomic DNA fragment into the pPD122.53(YFP) plasmid, which contains NLS4::YFP. The fragment (cgaatactggaaatatgatg --- ttttttqcccaattcccata)contains the 5'upstream region, 1st exon, 1st intron,2nd exon, and part of the 2nd intron of lin-12. The genomic region contains 17 putative LAG-1-binding sites. All 17 candidate binding sites were mutated in this transcriptional fusion construct. | ||
Genetic_information | Extrachromosomal | ||
Reference | WBPaper00042122 | ||
Species | Caenorhabditis elegans |