WormBase Tree Display for Variation: WBVar00089973
expand all nodes | collapse all nodes | view schema
WBVar00089973 | Evidence | Paper_evidence | WBPaper00002141 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1134 | |||||||
Other_name | CE05311:p.Met1? | ||||||||
C26C6.2.1:c.3G>A | |||||||||
HGVSg | CHROMOSOME_I:g.7522212G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26C6 | |||||
Flanking_sequences | ggtccaccgttcatcaactctagcgccat | ggttgtaccatgtcacaggaagagcgtgcc | |||||||
Mapping_target | C26C6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002141 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001648 | |||||||
Transcript | C26C6.2.1 | VEP_consequence | start_lost | ||||||
VEP_impact | HIGH | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.653 | possibly_damaging | |||||||
HGVSc | C26C6.2.1:c.3G>A | ||||||||
HGVSp | CE05311:p.Met1? | ||||||||
cDNA_position | 97 | ||||||||
CDS_position | 3 | ||||||||
Protein_position | 1 | ||||||||
Exon_number | 2/10 | ||||||||
Codon_change | atG/atA | ||||||||
Amino_acid_change | M/I | ||||||||
Interactor | WBInteraction000501273 | ||||||||
WBInteraction000503445 | |||||||||
WBInteraction000518668 | |||||||||
WBInteraction000542428 | |||||||||
WBInteraction000542432 | |||||||||
WBInteraction000542436 | |||||||||
WBInteraction000542440 | |||||||||
WBInteraction000555811 | |||||||||
Genetics | Interpolated_map_position | I | 2.09867 | ||||||
Description | Phenotype | WBPhenotype:0000004 | Paper_evidence | WBPaper00050796 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We evaluated this question by crossing the grk-2(gk268) and grk-2(rt97) alleles with strains that are constitutive egg layers. These strains include a gain-of-function strain that has activated Gαq (egl-30(ep271)) as well as loss-of-function strains that are defective in Gαo (goa-1(n1134)), the G protein that inhibits egg laying; EAT-16 (eat-16(ep273)), the regulator of G protein signaling (RGS) protein of Gαq; or diacylglycerol kinase (dgk-1(sy428)), a potential effector enzyme that phosphorylates diacylglycerol." (Figure 3A) | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0018991 | PATO:0002356 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000005 | Paper_evidence | WBPaper00031438 | |||||||
Curator_confirmed | WBPerson2369 | ||||||||
WBPhenotype:0000105 | Paper_evidence | WBPaper00027739 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Oocytes in mutant females exhibit increased meiotic maturation rates in the absence of sperm | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00027739 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006797 | PATO:0000460 | Paper_evidence | WBPaper00027739 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | fog-3(q443) | Paper_evidence | WBPaper00027739 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000384 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some axon guidance defects(?) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000546 | Paper_evidence | WBPaper00004721 | |||||||
WBPaper00032201 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals laid more embryos in the one- to eight-cell stage than at the normal 21-cell stage. | Paper_evidence | WBPaper00032201 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | 100% eggs laid are early (e.g. 8 or fewer cells.) (n=38) | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004721 | ||||||
WBPaper00032201 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | |||||||
WBPaper00041213 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson461 | |||||||||
Remark | Dispersal index in the absence of anesthetic ~0.96 was increased compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The locomotion rates of goa-1(n1134) mutants were more variable than those of wild-type animals; goa-1(n1134) mutants achieve greater peak acceleration, resulting in large fluctuations in the speed within tracks. | Paper_evidence | WBPaper00041213 | |||||||
Curator_confirmed | WBPerson461 | ||||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000642 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous animals are hyperactive as assayed by an increase in the number of body bends/min, ~29.9 (n=28) vs. N2 ~24.9 (n=26) | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001066 | Paper_evidence | WBPaper00003951 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Inactive phase was substantially shorter in goa-1 recessive mutant animals than in wild type | Paper_evidence | WBPaper00003951 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00003951 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00003951 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an significant increase in spontaneous reversals (~3.5 backward movements initiated/minute over 2 minutes) (n=28). n1134/+ animals do not exhibit a significant increase in reversals. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001619 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 of ~1.29 for isoflurane, whereas N2 has an EC50 of ~0.75 vol% as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay followed the protocol reported in Crowder et al. 1996 and van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001618 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 of ~0.47 for halothane, similar to N2 (EC50 ~0.42), as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay followed the protocol reported in Crowder et al. 1996 and van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002055 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Photocurrents appeared to be normal. | Paper_evidence | WBPaper00036207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |