WormBase Tree Display for Variation: WBVar00241333
expand all nodes | collapse all nodes | view schema
WBVar00241333 | Evidence | Paper_evidence | WBPaper00005804 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | r367ra236 | |||||
Other_name | C47E8.7.1:c.283G>A | ||||||
CE05443:p.Glu95Lys | |||||||
HGVSg | CHROMOSOME_V:g.14694935C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C47E8 | |||
Flanking_sequences | acacaattggagttcacaccaatgcataaa | aagcaagaattcagttaccagatatgcaaa | |||||
Mapping_target | C47E8 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005804 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Linked_to | WBVar00241329 | ||||||
Affects | Gene | WBGene00006836 | |||||
Transcript | C47E8.7.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0.28 | tolerated | |||||
PolyPhen | 0.079 | benign | |||||
HGVSc | C47E8.7.1:c.283G>A | ||||||
HGVSp | CE05443:p.Glu95Lys | ||||||
cDNA_position | 308 | ||||||
CDS_position | 283 | ||||||
Protein_position | 95 | ||||||
Exon_number | 4/8 | ||||||
Codon_change | Gaa/Aaa | ||||||
Amino_acid_change | E/K | ||||||
Genetics | Interpolated_map_position | V | 6.70021 | ||||
Reference | WBPaper00005804 | ||||||
Remark | ra236 is a revertant of r367. The allele alteration is same as the revertants ra202 and ra233 | Paper_evidence | WBPaper00005804 | ||||
Cis double mutant | |||||||
Method | Substitution_allele |