WormBase Tree Display for Variation: WBVar00241599
expand all nodes | collapse all nodes | view schema
WBVar00241599 | Evidence | Paper_evidence | WBPaper00004181 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | rh286 | ||||||
Other_name (15) | ||||||||
HGVSg | CHROMOSOME_X:g.10664082G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F11A1 | ||||
Flanking_sequences | acaaacggatgaacatgttttacgaaaatt | catccaatcggctctcgacagcccagaaaa | ||||||
Mapping_target | F11A1 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004181 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000007 | |||||||
Laboratory | NJ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000908 | ||||||
Transcript | F11A1.3b.1 (12) | |||||||
F11A1.3e.2 (12) | ||||||||
F11A1.3e.1 (12) | ||||||||
F11A1.3e.4 (12) | ||||||||
F11A1.3f.1 (12) | ||||||||
F11A1.3a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0.9 | tolerated | ||||||
PolyPhen | 0.468 | possibly_damaging | ||||||
HGVSc | F11A1.3a.1:c.1382G>A | |||||||
HGVSp | CE27584:p.Cys461Tyr | |||||||
cDNA_position | 1382 | |||||||
CDS_position | 1382 | |||||||
Protein_position | 461 | |||||||
Exon_number | 12/18 | |||||||
Codon_change | tGc/tAc | |||||||
Amino_acid_change | C/Y | |||||||
F11A1.3g.1 (12) | ||||||||
F11A1.3e.3 (12) | ||||||||
F11A1.3d.1 (12) | ||||||||
Genetics | Interpolated_map_position | X | 2.36907 | |||||
Description | Phenotype | WBPhenotype:0000137 | Paper_evidence | WBPaper00034661 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The daf-12(rh286) mutation resulted in reduced induction of mRNA expression of the genes mtl-2 and sod-3 in response to silver nanoparticle (AgNP) exposure, compared to wild type animals and as determined by qRT-PCR (Figure 4 compared to Figure 3A). | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000591 | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | daf-12(rh286) mutants exhibited a wild type response to the toxic effects of silver nanoparticles on reproduction (Table 1) | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00004181 | |||||||
WBPaper00034661 | ||||||||
Method | Substitution_allele |