WormBase Tree Display for Variation: WBVar00143469
expand all nodes | collapse all nodes | view schema
WBVar00143469 | Evidence | Paper_evidence | WBPaper00006395 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e767 | |||||||
Other_name (3) | |||||||||
HGVSg | CHROMOSOME_I:g.152861C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56C11 | |||||
Flanking_sequences | tgaatgagaatccaggtcttctctcatttg | tctgatcctcttccgttggcataactacaa | |||||||
Mapping_target | F56C11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004204 | ||||||||
WBStrain00026835 | |||||||||
WBStrain00027251 | |||||||||
WBStrain00028999 | |||||||||
WBStrain00057323 | |||||||||
Component_of_genotype | WBGenotype00000015 | ||||||||
Laboratory | CB | ||||||||
SHU | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000253 | |||||||
Transcript | F56C11.1.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | F56C11.1.1:c.737G>A | ||||||||
HGVSp | CE28463:p.Gly246Asp | ||||||||
cDNA_position | 773 | ||||||||
CDS_position | 737 | ||||||||
Protein_position | 246 | ||||||||
Exon_number | 6/21 | ||||||||
Codon_change | gGt/gAt | ||||||||
Amino_acid_change | G/D | ||||||||
F56C11.1.2 (12) | |||||||||
Interactor | WBInteraction000537316 | ||||||||
Genetics | Interpolated_map_position | I | -19.1473 | ||||||
Mapping_data | In_2_point | 1 | |||||||
2504 | |||||||||
3941 | |||||||||
4741 | |||||||||
7166 | |||||||||
7167 | |||||||||
In_multi_point (7) | |||||||||
In_pos_neg_data | 6276 | ||||||||
Description | Phenotype | WBPhenotype:0000025 | Paper_evidence | WBPaper00000031 | |||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson2987 | |||||||||
Remark | Variable slight blistering in adult. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000072 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Small irregular shape in adult. Difficult to score (ES2) in adult and late larvae. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00051549 | |||||||
Curator_confirmed | WBPerson15345 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00033445 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | When exposed to yeast infection, bli-3 mutants produced less ROS than wild-type | Paper_evidence | WBPaper00033445 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00033445 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The bli-3 mutant elicits the Dar disease earlier (after three days), in contrast to the wild type strain. Furthermore, yeast mutants that are unable to evoke the Dar response in wild type worms are competent to induce Dar in bli-3 mutant worms | Paper_evidence | WBPaper00033445 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00005747 | |||||||||
WBPaper00033445 | |||||||||
WBPaper00051549 | |||||||||
WBPaper00061175 | |||||||||
WBPaper00065026 | |||||||||
WBPaper00065304 | |||||||||
WBPaper00065993 | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |