WormBase Tree Display for Variation: WBVar00142908
expand all nodes | collapse all nodes | view schema
WBVar00142908 | Evidence | Paper_evidence | WBPaper00006395 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e12 | ||||||
Other_name | CE35021:p.Gly149Glu | |||||||
T21D12.2b.1:c.446G>A | ||||||||
T21D12.2a.1:c.446G>A | ||||||||
CE49091:p.Gly149Glu | ||||||||
HGVSg | CHROMOSOME_IV:g.258714C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T21D12 | ||||
Flanking_sequences | aatgtccaactggagctccaggaccaccag | acttccaggtaaatttgaattgcatcagga | ||||||
Mapping_target | T21D12 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004077 | |||||||
WBStrain00026744 | ||||||||
WBStrain00027172 | ||||||||
WBStrain00027245 | ||||||||
WBStrain00027276 | ||||||||
WBStrain00033525 | ||||||||
WBStrain00035533 | ||||||||
WBStrain00036391 | ||||||||
WBStrain00049370 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001071 | ||||||
Transcript | T21D12.2b.1 (12) | |||||||
T21D12.2a.1 (12) | ||||||||
Interactor | WBInteraction000503698 | |||||||
WBInteraction000537309 | ||||||||
Genetics | Interpolated_map_position | IV | -26.772 | |||||
Mapping_data | In_2_point | 91 | ||||||
92 | ||||||||
93 | ||||||||
94 | ||||||||
95 | ||||||||
96 | ||||||||
97 | ||||||||
443 | ||||||||
727 | ||||||||
838 | ||||||||
3272 | ||||||||
5216 | ||||||||
6178 | ||||||||
6184 | ||||||||
6186 | ||||||||
7000 | ||||||||
In_multi_point (25) | ||||||||
In_pos_neg_data | 2140 | |||||||
3687 | ||||||||
Description | Phenotype | WBPhenotype:0000135 | Paper_evidence | WBPaper00032031 | ||||
WBPaper00045575 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a high level of pnlp-29::GFP expression under normal culture conditions, unlike wild type worms. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
As measured by quantitative RT-PCR, the expression of all six genes of the nlp-29 locus was increased in a dpy-10-mutant background, to varying degrees. | Paper_evidence | WBPaper00045575 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000319 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Large dumpy. Easy to score (ES3) in adult, very hard to score (ES1) in larvae. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to levamisole (Figure 3K) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000462 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to paraquat (Figure 3B) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00032031 | ||||||||
WBPaper00032090 | ||||||||
WBPaper00005747 | ||||||||
WBPaper00064435 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
WBPerson6532 | ||||||||
Remark | Large dumpy. Easy to score (ES3) in adult, very hard to score (ES1) in larvae. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Authors report "large dpy" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals resist osmotic stress. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00061220 | ||||||
WBPaper00064435 | ||||||||
Curator_confirmed | WBPerson3900 | |||||||
WBPerson6532 | ||||||||
Remark | Irregular indentations in the cuticle (Figure 2) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00032031 | ||||||
WBPaper00061220 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson3900 | ||||||||
Remark | Animals had a markedly increased resistance to D. coniospora infection. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Enhanced resistance to Pseudomonas aeruginosa (Figure S4G) | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | loss of dpy-2 or dpy-9 gene function is associated with increased GFP::DBL-1 fluorescence from texIs100 or texIs101 as shown in (A') and (B'), respectively. dpy-2 and dpy-9 mutants also have reduced spp-9p::gfp reporter activity compared to control (C), as shown in (C') and (C''), respectively. | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | TLG702 dpy-9(e12); texIs101 | Paper_evidence | WBPaper00058872 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00058872 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Consistent with the increased GFP::DBL-1 fluorescence at L4, we observed significantly decreased fluorescence from the spp-9p::gfp reporter at L4 (Figure 1, Table 1). T | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014937 | Paper_evidence | WBPaper00058872 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | TLG724 dpy-9(e12); texIs127 | Paper_evidence | WBPaper00058872 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "multiple or discontinuous ala" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "missing or amorphous annuli" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001918 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Enhanced susceptibility to ivermectin (Figure 3L) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00061220 | ||||
Curator_confirmed | WBPerson3900 | |||||||
WBPhenotype:0002575 | Paper_evidence | WBPaper00064435 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
WBPhenotype:0002641 | Paper_evidence | WBPaper00061220 | ||||||
Curator_confirmed | WBPerson3900 | |||||||
Remark | Cuticle permeable to Hoechst 33258 (Figure S1) | Paper_evidence | WBPaper00061220 | |||||
Curator_confirmed | WBPerson3900 | |||||||
Phenotype_not_observed (3) | ||||||||
Disease_info | Models_disease | DOID:37 | ||||||
Models_disease_in_annotation | WBDOannot00001177 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |