WormBase Tree Display for Variation: WBVar00142954
expand all nodes | collapse all nodes | view schema
| WBVar00142954 | Evidence | Paper_evidence | WBPaper00044340 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e91 | |||||||
| Other_name | Y57A10A.11.1:c.238C>T | ||||||||
| CE22614:p.Arg80Cys | |||||||||
| HGVSg | CHROMOSOME_II:g.12173668C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y57A10A | |||||
| Flanking_sequences | tcatttacacgtggattcaaccgtaccgcc | gtcaagctggctacgagtactcgaatgatg | |||||||
| Mapping_target | Y57A10A | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00044340 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (20) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004394 | |||||||
| Transcript | Y57A10A.11.1 (12) | ||||||||
| Interactor | WBInteraction000052484 | ||||||||
| WBInteraction000052497 | |||||||||
| WBInteraction000052504 | |||||||||
| WBInteraction000052505 | |||||||||
| WBInteraction000052506 | |||||||||
| WBInteraction000052507 | |||||||||
| WBInteraction000052508 | |||||||||
| WBInteraction000052509 | |||||||||
| Genetics (3) | |||||||||
| Description | Phenotype (4) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (15) | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
