WormBase Tree Display for Variation: WBVar00142954
expand all nodes | collapse all nodes | view schema
WBVar00142954 | Evidence | Paper_evidence | WBPaper00044340 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | Y57A10A | |||||
Flanking_sequences | tcatttacacgtggattcaaccgtaccgcc | gtcaagctggctacgagtactcgaatgatg | |||||||
Mapping_target | Y57A10A | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00044340 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (20) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004394 | |||||||
Transcript | Y57A10A.11.1 (12) | ||||||||
Interactor | WBInteraction000052484 | ||||||||
WBInteraction000052497 | |||||||||
WBInteraction000052504 | |||||||||
WBInteraction000052505 | |||||||||
WBInteraction000052506 | |||||||||
WBInteraction000052507 | |||||||||
WBInteraction000052508 | |||||||||
WBInteraction000052509 | |||||||||
Genetics | Interpolated_map_position | II | 6.89249 | ||||||
Mapping_data | In_2_point (6) | ||||||||
In_multi_point | 54 | ||||||||
58 | |||||||||
319 | |||||||||
633 | |||||||||
700 | |||||||||
842 | |||||||||
849 | |||||||||
1053 | |||||||||
1056 | |||||||||
1058 | |||||||||
1062 | |||||||||
1242 | |||||||||
1354 | |||||||||
1393 | |||||||||
1394 | |||||||||
1395 | |||||||||
1572 | |||||||||
2002 | |||||||||
2660 | |||||||||
2796 | |||||||||
3220 | |||||||||
3303 | |||||||||
In_pos_neg_data | 1542 | ||||||||
1553 | |||||||||
2141 | |||||||||
Marked_rearrangement | mIn1[rol-1(e91) dpy-10(e128)] | ||||||||
mIn1[rol-1(e91)] | |||||||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000465 | |||||
WBPaper00000906 | |||||||||
WBPaper00001396 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson469 | |||||||||
Remark | adults left-handed rollers | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Only animals expressing adult cuticle will roll; thus, lin-29 rol-1 will not roll. | Paper_evidence | WBPaper00001396 | |||||||
Curator_confirmed | WBPerson469 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00000906 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak Dumpy in dauer stage only. Adults not Dpy at any temperature. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000645 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make a 1/2 turn along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |