WormBase Tree Display for Variation: WBVar00143004
expand all nodes | collapse all nodes | view schema
WBVar00143004 | Evidence | Person_evidence | WBPerson261 | ||
---|---|---|---|---|---|
WBPerson2629 | |||||
Name | Public_name | e164 | |||
Other_name | CE11066:p.Gln189Ter | ||||
F54D8.1.1:c.565C>T | |||||
HGVSg | CHROMOSOME_III:g.5107949C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F54D8 | |
Flanking_sequences | gacggagaagatgctgatgatgccaaggct | agactcaacaatacgatggatgcttcactt | |||
Mapping_target | F54D8 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (201) | |||||
Laboratory (2) | |||||
Status | Live | ||||
Affects | Gene | WBGene00001076 | |||
Transcript | F54D8.1.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | F54D8.1.1:c.565C>T | ||||
HGVSp | CE11066:p.Gln189Ter | ||||
cDNA_position | 568 | ||||
CDS_position | 565 | ||||
Protein_position | 189 | ||||
Exon_number | 3/4 | ||||
Codon_change | Cag/Tag | ||||
Amino_acid_change | Q/* | ||||
Interactor | WBInteraction000502314 | ||||
WBInteraction000537325 | |||||
Genetics | Interpolated_map_position | III | -2.13511 | ||
Mapping_data | In_2_point (29) | ||||
In_multi_point | 68 | ||||
315 | |||||
324 | |||||
325 | |||||
376 | |||||
377 | |||||
378 | |||||
429 | |||||
488 | |||||
491 | |||||
492 | |||||
498 | |||||
502 | |||||
506 | |||||
513 | |||||
580 | |||||
585 | |||||
589 | |||||
600 | |||||
611 | |||||
613 | |||||
629 | |||||
630 | |||||
729 | |||||
746 | |||||
754 | |||||
862 | |||||
863 | |||||
865 | |||||
868 | |||||
871 | |||||
877 | |||||
895 | |||||
1078 | |||||
1089 | |||||
1251 | |||||
1363 | |||||
1405 | |||||
1407 | |||||
1412 | |||||
1413 | |||||
1415 | |||||
1419 | |||||
1421 | |||||
1489 | |||||
1491 | |||||
1492 | |||||
1496 | |||||
1497 | |||||
1499 | |||||
1500 | |||||
1503 | |||||
1504 | |||||
1623 | |||||
1624 | |||||
1634 | |||||
1637 | |||||
1669 | |||||
1726 | |||||
1736 | |||||
1754 | |||||
1755 | |||||
1817 | |||||
1850 | |||||
1851 | |||||
1853 | |||||
2007 | |||||
2012 | |||||
2013 | |||||
2018 | |||||
2055 | |||||
2075 | |||||
2077 | |||||
2078 | |||||
2079 | |||||
2081 | |||||
2082 | |||||
2083 | |||||
2084 | |||||
2085 | |||||
2099 | |||||
2100 | |||||
2102 | |||||
2104 | |||||
2108 | |||||
2151 | |||||
2178 | |||||
2179 | |||||
2223 | |||||
2224 | |||||
2225 | |||||
2242 | |||||
2243 | |||||
2245 | |||||
2247 | |||||
2304 | |||||
2305 | |||||
2307 | |||||
2308 | |||||
2312 | |||||
2425 | |||||
2692 | |||||
2706 | |||||
2740 | |||||
2741 | |||||
2742 | |||||
2744 | |||||
2755 | |||||
2760 | |||||
2761 | |||||
2791 | |||||
2799 | |||||
2800 | |||||
3015 | |||||
3110 | |||||
3138 | |||||
3166 | |||||
3191 | |||||
3206 | |||||
3217 | |||||
3218 | |||||
3219 | |||||
3223 | |||||
3224 | |||||
3225 | |||||
3235 | |||||
3297 | |||||
3298 | |||||
3299 | |||||
3300 | |||||
3301 | |||||
3302 | |||||
3304 | |||||
3324 | |||||
3325 | |||||
3326 | |||||
3327 | |||||
3328 | |||||
3329 | |||||
3330 | |||||
3331 | |||||
3332 | |||||
3333 | |||||
3334 | |||||
3335 | |||||
3336 | |||||
3337 | |||||
3338 | |||||
3339 | |||||
3340 | |||||
In_pos_neg_data | 1578 | ||||
1582 | |||||
1586 | |||||
1596 | |||||
1616 | |||||
3244 | |||||
Description (2) | |||||
Reference (20) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |