WormBase Tree Display for Variation: WBVar00143004
expand all nodes | collapse all nodes | view schema
WBVar00143004 | Evidence | Person_evidence | WBPerson261 | |||||
---|---|---|---|---|---|---|---|---|
WBPerson2629 | ||||||||
Name | Public_name | e164 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_III:g.5107949C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F54D8 | ||||
Flanking_sequences | gacggagaagatgctgatgatgccaaggct | agactcaacaatacgatggatgcttcactt | ||||||
Mapping_target | F54D8 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (201) | ||||||||
Laboratory (2) | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001076 | ||||||
Transcript | F54D8.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54D8.1.1:c.565C>T | |||||||
HGVSp | CE11066:p.Gln189Ter | |||||||
cDNA_position | 568 | |||||||
CDS_position | 565 | |||||||
Protein_position | 189 | |||||||
Exon_number | 3/4 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000502314 | |||||||
WBInteraction000537325 | ||||||||
Genetics | Interpolated_map_position | III | -2.13511 | |||||
Mapping_data | In_2_point (29) | |||||||
In_multi_point | 68 | |||||||
315 | ||||||||
324 | ||||||||
325 | ||||||||
376 | ||||||||
377 | ||||||||
378 | ||||||||
429 | ||||||||
488 | ||||||||
491 | ||||||||
492 | ||||||||
498 | ||||||||
502 | ||||||||
506 | ||||||||
513 | ||||||||
580 | ||||||||
585 | ||||||||
589 | ||||||||
600 | ||||||||
611 | ||||||||
613 | ||||||||
629 | ||||||||
630 | ||||||||
729 | ||||||||
746 | ||||||||
754 | ||||||||
862 | ||||||||
863 | ||||||||
865 | ||||||||
868 | ||||||||
871 | ||||||||
877 | ||||||||
895 | ||||||||
1078 | ||||||||
1089 | ||||||||
1251 | ||||||||
1363 | ||||||||
1405 | ||||||||
1407 | ||||||||
1412 | ||||||||
1413 | ||||||||
1415 | ||||||||
1419 | ||||||||
1421 | ||||||||
1489 | ||||||||
1491 | ||||||||
1492 | ||||||||
1496 | ||||||||
1497 | ||||||||
1499 | ||||||||
1500 | ||||||||
1503 | ||||||||
1504 | ||||||||
1623 | ||||||||
1624 | ||||||||
1634 | ||||||||
1637 | ||||||||
1669 | ||||||||
1726 | ||||||||
1736 | ||||||||
1754 | ||||||||
1755 | ||||||||
1817 | ||||||||
1850 | ||||||||
1851 | ||||||||
1853 | ||||||||
2007 | ||||||||
2012 | ||||||||
2013 | ||||||||
2018 | ||||||||
2055 | ||||||||
2075 | ||||||||
2077 | ||||||||
2078 | ||||||||
2079 | ||||||||
2081 | ||||||||
2082 | ||||||||
2083 | ||||||||
2084 | ||||||||
2085 | ||||||||
2099 | ||||||||
2100 | ||||||||
2102 | ||||||||
2104 | ||||||||
2108 | ||||||||
2151 | ||||||||
2178 | ||||||||
2179 | ||||||||
2223 | ||||||||
2224 | ||||||||
2225 | ||||||||
2242 | ||||||||
2243 | ||||||||
2245 | ||||||||
2247 | ||||||||
2304 | ||||||||
2305 | ||||||||
2307 | ||||||||
2308 | ||||||||
2312 | ||||||||
2425 | ||||||||
2692 | ||||||||
2706 | ||||||||
2740 | ||||||||
2741 | ||||||||
2742 | ||||||||
2744 | ||||||||
2755 | ||||||||
2760 | ||||||||
2761 | ||||||||
2791 | ||||||||
2799 | ||||||||
2800 | ||||||||
3015 | ||||||||
3110 | ||||||||
3138 | ||||||||
3166 | ||||||||
3191 | ||||||||
3206 | ||||||||
3217 | ||||||||
3218 | ||||||||
3219 | ||||||||
3223 | ||||||||
3224 | ||||||||
3225 | ||||||||
3235 | ||||||||
3297 | ||||||||
3298 | ||||||||
3299 | ||||||||
3300 | ||||||||
3301 | ||||||||
3302 | ||||||||
3304 | ||||||||
3324 | ||||||||
3325 | ||||||||
3326 | ||||||||
3327 | ||||||||
3328 | ||||||||
3329 | ||||||||
3330 | ||||||||
3331 | ||||||||
3332 | ||||||||
3333 | ||||||||
3334 | ||||||||
3335 | ||||||||
3336 | ||||||||
3337 | ||||||||
3338 | ||||||||
3339 | ||||||||
3340 | ||||||||
In_pos_neg_data | 1578 | |||||||
1582 | ||||||||
1586 | ||||||||
1596 | ||||||||
1616 | ||||||||
3244 | ||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000572 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | low penetrance defects in outgrowth of posterior canal cell processes | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00032031 | ||||||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark | Animals are morphologically similar to dpy-9. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
medium dumpy, spindle-shaped adult; old adults sometimes less dumpy; strong dumpy L1 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption with branching" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "severe disruption" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 98.9% animals hatch (n=284). | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000535 | Paper_evidence | WBPaper00006477 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 100% hatched animals have normal body morphology. | Paper_evidence | WBPaper00006477 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited levels of pnlp-29::GFP similar to wild-type controls under normal culture conditions. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000876 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are no more resistant to high salt than wild-type worms. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to D. coniospora infection as wild type worms. | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Infections with a freshly harvested solution of D. coniospora spores were done as described [65]; worms were analyzed after 24 h at 25C. Worms were pricked in the tail region using a microinjection needle under a dissecting microscope and analyzed 6 h later for GFP induction or 2 hours later for qRT-PCR. | Paper_evidence | WBPaper00032031 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference (20) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |